Water activity raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
This page was last updated on 2025-09-03 and is reviewed periodically as new material appears.
Production usually starts with whey protein concentrate or isolate. The material is dissolved, pasteurized, and adjusted to conditions that favor a chosen protease, such as trypsin, pepsin, or papain. Enzyme choice, pH, temperature, and reaction time determine peptide length, terminal residues, and functional behavior. After hydrolysis, the enzyme is inactivated by heat or pH change, and the liquid is clarified, filtered, concentrated, and dried. Membrane filtration can further fractionate peptides and remove some minerals or lactose. The final powder is typically spray-dried.
Composition reflects the whey source and the extent of hydrolysis. Beta-lactoglobulin and alpha-lactalbumin fragments are common, and sweet whey may contribute glycomacropeptide. The amino acid profile remains broadly similar to intact whey protein, but peptide size affects how quickly nitrogen appears in blood after ingestion. Bitter notes often arise from short peptides with hydrophobic residues. Hydrolysates are used in sports nutrition, infant formula, and clinical nutrition, though effects on muscle, immunity, or allergy risk are separate research questions rather than guaranteed properties.
Physical properties such as particle size, bulk density, and reconstitution behavior affect handling and finished product quality. Water activity and moisture content influence shelf life; high moisture can promote caking, browning, and microbial growth. Color is monitored because Maillard reactions between peptides and reducing sugars can darken the powder during storage. Taste panels and instrumental methods may assess bitterness, which is a common challenge for hydrolysates. Specifications often include limits for heavy metals, microbiological counts, and residual fat, depending on the intended market.
Quality control for hydrolyzed whey protein focuses on composition, peptide size, and batch consistency. Protein content is commonly measured by Kjeldahl or combustion analysis, while moisture and ash are determined by gravimetric methods. Peptide molecular weight distribution is often assessed by size exclusion chromatography or mass spectrometry. The extent of hydrolysis can be estimated by titration, trinitrobenzenesulfonic acid assays, or formol titration. Because hydrolysis produces a complex mixture, no single test captures every relevant property, and laboratories often combine several methods.
Allergen testing is relevant because whey is a milk-derived ingredient. Immunoassays can detect residual milk proteins, but hydrolysis may alter or destroy antibody-binding sites, leading to false negatives or underestimation. Liquid chromatography with tandem mass spectrometry can identify specific peptide markers and is less dependent on intact protein epitopes. Regulatory labeling rules for milk allergens vary by country, and a product described as hydrolyzed is not automatically exempt from allergen declaration. For infants, specialized formulas require strict control of protein molecular weight and sterility, which adds testing beyond routine composition.
| Property | Value | Notes |
|---|---|---|
| Appearance | Off-white to pale cream powder | Spray-dried form; color varies by batch |
| Protein content (dry basis) | 70–90% | Depends on whey source and filtration |
| Degree of hydrolysis | 5–30% | Partial to extensive; assay-dependent |
| Water solubility | Soluble at pH 2–7 | May form slightly turbid solutions |
| Recommended storage | 15–25 °C, dry | Protect from moisture, heat, and light |
Production typically begins with pasteurization and concentration of whey. A protease is added under controlled temperature and pH, and the reaction is stopped by heat or pH change when the target extent of cleavage is reached. Ultrafiltration or diafiltration may remove enzymes, salts, and small molecules. The liquid is then spray dried into a powder. Process parameters shape bitterness, solubility, and peptide size. Established control points include enzyme type, reaction time, and inactivation conditions. How these variables interact across large-scale batches remains an area of active process development.
Hydrolysates usually contain 70% to 90% protein on a dry basis, with variable ash, fat, and carbohydrate. Solubility in water is generally high over a broad pH range, though bitter notes can appear from exposed hydrophobic peptides. The powder tends to absorb moisture and may brown during prolonged warm storage. Applications span sports nutrition, clinical nutrition, infant formulas, and flavor systems. Regulatory status and labeling rules differ by country. A key open question is whether a given peptide profile reliably predicts functional or sensory behavior across different food matrices.
Hydrolysates are generally stable as dry powders but can absorb moisture and undergo browning during warm storage. The bitter taste of some hydrolysates arises from hydrophobic peptides exposed by cleavage, and it varies with enzyme choice and degree of hydrolysis. Reduced allergenicity is sometimes claimed, but residual IgE-binding peptides may remain, especially in partial hydrolysates. Regulatory frameworks treat extensively hydrolyzed and partially hydrolyzed products differently, and labeling rules vary by country. More research is needed on how specific peptide profiles relate to clinical outcomes.
Commercial production begins with whey protein concentrate or isolate dissolved in water. A protease is added under controlled pH and temperature, and the reaction is stopped by heat or pH adjustment once a target degree of hydrolysis is reached. Membrane filtration, often ultrafiltration or diafiltration, removes enzymes and small solutes while retaining peptides. The liquid is then concentrated and spray-dried into a powder. Each step influences peptide length, mineral content, and flavor.
== Further reading == Markwell, John; Brooks, David W. (2002). "Broken Links: The Ephemeral Nature of Educational WWW Hyperlinks". Journal of Science Education and Technology. 11 (2): 105–108. Bibcode:2002JSEdT..11..105M. doi:10.1023/A:1014627511641. Gomes, Daniel; Silva, Mário J. (2006). "Modelling Information Persistence on the Web" (PDF). Proceedings of the 6th International Conference on Web Engineering. ICWE'06. Archived from the original (PDF) on 2011-07-16. Retrieved 14 September 2010. Dellavalle, Robert P.; Hester, Eric J.; Heilig, Lauren F.; Drake, Amanda L.; Kuntzman, Jeff W.; Graber, Marla; Schilling, Lisa M. (31 October 2003). "Going, Going, Gone: Lost Internet References". Science. 302 (5646): 787–788. doi:10.1126/science.1088234. PMID 14593153. Koehler, Wallace (1999). "An Analysis of Web Page and Web Site Constancy and Permanence". Journal of the American Society for Information Science. 50 (2): 162–180. doi:10.1002/(SICI)1097-4571(1999)50:2<162::AID-ASI7>3.0.CO;2-B. Sellitto, Carmine (2005). "The impact of impermanent Web-located citations: A study of 123 scholarly conference publications" (PDF). Journal of the American Society for Information Science and Technology. 56 (7): 695–703. doi:10.1002/asi.20159.
== Arts and entertainment == V.I.P. (comedian), an Indian television comedian VIP (magazine), an Irish celebrity lifestyle fashion magazine VIP, a video brand formerly used by Japanese adult video company Atlas21 V.I.P. (talk show), a 1973–1983 Canadian television talk show V.I.P. (American TV series), a 1998–2002 American television series starring Pamela Anderson Very Important People (2012 TV series), a British television sketch show VIP (South Korean TV series), a 2019 South Korean television series Very Important People (2023 TV series), an American improvisational comedy web show VIP Magazin, a Moldovan celebrity lifestyle magazine VIPs (Squid Game), antagonists in the South Korean television series Squid Game
Tens of thousands of black men were conscripted from rural communities for work, first on the aerodromes and later on white-owned farms. World War II prompted major changes in Southern Rhodesia's financial and military policy, and accelerated the process of industrialisation. The territory's participation in the EATS brought about major economic and infrastructural developments and led to the post-war immigration of many former airmen, contributing to the growth of the white population to over double its pre-war size by 1951. The war remained prominent in the national consciousness for decades afterwards. Since the country's reconstitution as Zimbabwe in 1980, the modern government has removed many references to the World Wars, such as memorial monuments and plaques, from public view, regarding them as unwelcome vestiges of white minority rule and colonialism, despite many Rhodesian servicemen serving in the war being black.
== Use == Once extracted, oil is refined and separated, most easily by distillation, into numerous products for direct use or use in manufacturing, such as gasoline (petrol), diesel and kerosene to asphalt and chemical reagents (ethylene, propylene, butene, acrylic acid, para-xylene) used to make plastics, pesticides and pharmaceuticals. In terms of volume, most petroleum is converted into fuels for combustion engines. In terms of value, petroleum underpins the petrochemical industry, which includes many high value products such as pharmaceuticals and plastics. By volume, 84% of hydrocarbons present in petroleum are converted into fuels.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Sources: en.wikipedia.org
Spironolactone is widely used as an antiandrogen in feminizing hormone therapy for transfeminine people and is recommended by transgender medicine clinical guidelines for such purposes. It is the most commonly used antiandrogen in transfeminine people in the United States, whereas cyproterone acetate (CPA), which is not available in the United States, is widely used in Europe and throughout the rest of the world. Spironolactone is inferior to CPA, other progestogens, GnRH modulators, and high-dose parenteral estradiol monotherapy in terms of achieving adequate testosterone suppression in transfeminine people. However, spironolactone acts as a direct though weak androgen receptor antagonist rather than by suppressing testosterone levels, and hence its antiandrogenic effects and potential therapeutic benefits in this context are not necessarily reflected in testosterone levels. In any case, while widely used, there remain very limited comparative clinical data on spironolactone versus other antiandrogenic approaches in terms of physical feminization outcomes in transfeminine people.
=== Estimates on how much is needed === The amount of YAN needed will depend on what the winemaker's goals are for fermentation, particularly whether or not wild fermentation is desired or if the wine will be fully fermented to dryness. The state of the grapes and the conditions of fermentation will influence the amount of nitrogen needed. Fruit that is damaged, moldy or botrytis infected will usually be more depleted of nitrogen (as well as other vitamin resources) when they come in from the vineyard than clean, intact grapes. This depletion can be further exacerbated by over clarification of the must and high sugar content. Wines fermented at higher temperatures tend to progress at a faster rate, requiring more nitrogen than longer, cooler fermentation. Also the amount of oxygen exposure will influence the rate of nitrogen uptake by the yeast with wine fermented in complete anaerobic conditions (such as many white wines in stainless steel tanks) requiring less nitrogen than wines fermented in barrels or open top fermentors. The suggested range given by enologists varies from 150 mg/L YAN to 400 mg of nitrogen per liter. Some studies have shown that maximum fermentation rates can be achieved with YAN in the 400 to 500 mg N/L range. However, not all winemakers will want to have a fermentation going at maximum rate (in terms of yeast biomass, temperature and speed) due to the impact that it can have on other sensory aspects of the wine such as aroma development and fruit retention.
=== Persona non grata === The government of a country can declare a diplomat persona non grata, banning them from entering the country or expelling them if they have already entered. In non-diplomatic use, the authorities of a country may also declare a foreigner persona non grata permanently or temporarily, usually because of unlawful activity.
CoA + acetyl-[acyl-carrier-protein] Thus, the two substrates of this enzyme are acetyl-CoA and acyl carrier protein, whereas its two products are CoA and acetyl-acyl-carrier-protein. This enzyme belongs to the family of transferases, specifically those acyltransferases transferring groups other than aminoacyl groups. The systematic name of this enzyme class is acetyl-CoA:[acyl-carrier-protein] S-acetyltransferase. Other names in common use include acetyl coenzyme A-acyl-carrier-protein transacylase, acetyl-CoA:ACP transacylase, [acyl-carrier-protein]acetyltransferase, [ACP]acetyltransferase, and ACAT. This enzyme participates in fatty acid biosynthesis.
Sources: en.wikipedia.org
Whey protein hydrolysate is whey protein that has been treated with enzymes or acid to break peptide bonds into smaller peptides. It is not a different protein source; it is a modified form of whey protein. Commercial products range from partially to extensively hydrolyzed.
Hydrolysis lowers average molecular weight and can improve solubility near the isoelectric point while reducing viscosity. It also exposes hydrophobic groups, which often increases bitterness. These changes affect foaming, gelling, and taste in food formulations.
No. Whey protein isolate is a purified form of whey protein with high protein content and low lactose or fat. Hydrolysate refers to whey protein that has undergone hydrolysis and can be made from isolate or concentrate. The two terms describe different processing categories.
Size exclusion chromatography separates peptides by molecular size in solution, and mass spectrometry can provide more detailed mass information. Results are usually reported as a distribution rather than a single value. Method choice and calibration affect the reported range.